Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-27a URS00003B95DA_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-27a: Ssc-mir-27a is a type of microRNA that has been studied in various contexts. In a study on castrated male pigs, it was found that ssc-mir-27a was decreased in expression, along with ssc-miR-378, which is consistent with previous research showing that ssc-mir-27a negatively regulates adipocyte differentiation by inhibiting the expression of PPARγ [PMC3901342]. In intact male pigs, the expression levels of ssc-miR-21, ssc-miR-142-5p, ssc-mir-27a, ssc-miR-7134-3p and ssc-miR-103 were significantly higher compared to castrated male pigs [PMC3901342]. Long-term dietary resveratrol supplementation in pigs increased intramuscular fat content and upregulated the mRNA expression of PPARγ and other genes while downregulating the mRNA expression of CPT-1, SIRT1, and PPARα. This effect may be related to enhanced expression of ssc-miR-181a, ssc-miR-370, and reduced expression of ssc-mir-27a [PMC9921422]. Ssc-mir 27a was also found to be one of the most abundant miRNAs in liver samples [PMC6856533]. Additionally, it has been observed that miRNAs such as sccm mir 27a are associated with cell cycle regulation and apoptosis [PMC3968000]. Some small RNAs are generated from the loop or region between loop and stem structures in miRNAs such as let7e mir 27a and miRNA 30A [PMC4008308]. In a study on PRV infection in pigs it was found that mir 27A was upregulated while other miRNAs were downregulated [PMC4801506].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCACAGUGGCUAAGUUCCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 44 other species

  1. Alligator mississippiensis ami-miR-27a-3p
  2. Anolis carolinensis aca-miR-27a-3p
  3. Bos taurus (cattle) Bta-Mir-27-P3_3p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-27a
  5. Callorhinchus milii Cmi-Mir-27-P3_3p (mature (guide))
  6. Canis lupus familiaris Cfa-Mir-27-P3_3p (mature (guide))
  7. Capra hircus (goat) miR-27a
  8. Cervus elaphus cel-miR-27a-3p
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-27-P3_3p (mature (guide))
  10. Chrysemys picta cpi-miR-27a-3p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-27a-3p
  12. Cyprinus carpio ccr-miR-27a
  13. Danio rerio Dre-Mir-27-P1_3p (mature (guide))
  14. Dasypus novemcinctus (nine-banded armadillo) dno-miR-27a-3p
  15. Echinops telfairi Ete-Mir-27-P3_3p (mature (guide))
  16. Equus caballus eca-miR-27a
  17. Gadus morhua Gmo-Mir-27-P1_3p (mature (guide))
  18. Gallus gallus (chicken) Gga-Mir-27-P3_3p (mature (guide))
  19. Gekko japonicus Gja-Mir-27-P3_3p (mature (guide))
  20. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-27a
  21. Homo sapiens hsa-miR-27a-3p
  22. Latimeria chalumnae Lch-Mir-27-P3_3p (mature (guide))
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-27-P1_3p (mature (guide))
  24. Macaca mulatta Mml-Mir-27-P3_3p (mature (guide))
  25. Maylandia zebra (zebra mbuna) mze-miR-27a
  26. Monodelphis domestica mdo-miR-27a-3p
  27. Monopterus albus Mal-Mir-27-P1_3p (mature (guide))
  28. Mus musculus (house mouse) mmu-miR-27a-3p
  29. Neolamprologus brichardi (lyretail cichlid) nbr-miR-27a
  30. Oreochromis niloticus oni-miR-27a
  31. Ornithorhynchus anatinus oan-miR-27a-3p
  32. Oryctolagus cuniculus Ocu-Mir-27-P3_3p (mature (guide))
  33. Ovis aries oar-miR-27a
  34. Pundamilia nyererei pny-miR-27a
  35. Python bivittatus pbv-miR-27a-3p
  36. Rattus norvegicus rno-miR-27a-3p
  37. Saimiri boliviensis boliviensis sbo-miR-27a
  38. Sarcophilus harrisii Sha-Mir-27-P3_3p (mature (guide))
  39. Scyliorhinus torazame (cloudy catshark) Sto-Mir-27-P3b_3p (mature (guide))
  40. Taeniopygia guttata (zebra finch) Tgu-Mir-27-P3_3p (mature (guide))
  41. Tetraodon nigroviridis Tni-Mir-27-P1_3p (mature (guide))
  42. Tursiops truncatus miR-27a
  43. Xenopus laevis (African clawed frog) Xla-Mir-27-P3c_3p (mature (guide))
  44. Xenopus tropicalis xtr-miR-27a
Publications