Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gorilla gorilla (western gorilla) microRNA ggo-mir-18a precursor secondary structure diagram

Gorilla gorilla (western gorilla) microRNA ggo-mir-18a precursor URS00003B0CDB_9593

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 18a (ENSANAG00000006847.1)
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-18 precursor
  3. Bos taurus (cattle) microRNA bta-mir-18a precursor
  4. Capra hircus (Goat) microRNA mir-18a (ENSCHIG00000001825.1)
  5. Carlito syrichta microRNA 18a (ENSTSYG00000028825.1)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA 18a (ENSCCAG00000009401.1)
  7. Cercocebus atys (Sooty mangabey) microRNA 18a (ENSCATG00000022345.1)
  8. Colobus angolensis palliatus (Angola colobus) miRNA (ENSCANG00000017374.1)
  9. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-18a (ENSGGOG00000030480.2)
  10. Homo sapiens microRNA hsa-mir-18a precursor
  11. Lagothrix lagotricha microRNA lla-mir-18 precursor
  12. Lemur catta microRNA lca-mir-18 precursor
  13. Macaca mulatta microRNA mml-mir-18a precursor
  14. Macaca nemestrina microRNA mne-mir-18 precursor
  15. Mandrillus leucophaeus microRNA 18a (ENSMLEG00000020493.1)
  16. Microcebus murinus (gray mouse lemur) mmr-mir-18 (ENSMICG00000018153.3)
  17. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 18a (ENSNLEG00000021479.2)
  18. Pan paniscus microRNA ppa-mir-18 precursor
  19. Panthera pardus (leopard) microRNA 18a (ENSPPRG00000013539.1)
  20. Panthera tigris altaica (Tiger) microRNA 18a (ENSPTIG00000003433.1)
  21. Pan troglodytes microRNA ptr-mir-18a precursor
  22. Pongo abelii (Sumatran orangutan) miRNA
  23. Pongo pygmaeus microRNA ppy-mir-18a precursor
  24. Propithecus coquereli (Coquerel's sifaka) microRNA 18a (ENSPCOG00000010698.1)
  25. Rhinopithecus bieti microRNA 18a (ENSRBIG00000015235.1)
  26. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 18a (ENSRROG00000010065.1)
  27. Saguinus labiatus microRNA sla-mir-18 precursor
  28. Saimiri boliviensis boliviensis microRNA 18a (ENSSBOG00000001425.1)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications