Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-152 URS00003AFD9B_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-152: Ssc-mir-152 is a known microRNA (miRNA) that is involved in the regulation of gene expression in pigs and has been observed to have differential expression in response to various stimuli and conditions. In a study examining the response of porcine peripheral blood mononuclear cells (PBMCs) to lipopolysaccharide (LPS) stimulation, ssc-mir-152 was found to be down-regulated [PMC7903524]. This miRNA, along with others, showed changes in expression upon LPS stimulation, suggesting a potential role in the inflammatory process [PMC7903524]. Ssc-mir-152 has been identified as one of the miRNAs with more abundant expression levels in PBMCs compared to other differentially expressed miRNAs [PMC7903524]. Moreover, ssc-mir-152 was one of the miRNAs that exhibited decreased expression levels in pigs susceptible to E. coli F18 infection [PMC3427155], indicating its potential involvement in disease susceptibility. This miRNA is also expressed across various pig tissues, suggesting a broad regulatory role [PMC3427155]. Further research is needed to elucidate the specific functions and target genes of ssc-mir-152 within inflammatory pathways and disease processes [PMC7903524].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCAUGACAGAACUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis (American alligator) ami-miR-152-3p
  2. Bos taurus (domestic cattle) Bta-Mir-148-P3_3p (mature (guide))
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-152
  4. Canis lupus familiaris cfa-miR-152
  5. Cavia porcellus cpo-miR-152-3p
  6. Cervus elaphus cel-miR-152
  7. Chrysemys picta bellii Cpi-Mir-148-P3_3p (mature (guide))
  8. Chrysemys picta (Painted turtle) cpi-miR-152-3p
  9. Cricetulus griseus cgr-miR-152-3p
  10. Equus caballus (horse) Eca-Mir-148-P3_3p (mature (guide))
  11. Gorilla gorilla gorilla ggo-miR-152 (MIR152)
  12. Gorilla gorilla (western gorilla) ggo-miR-152
  13. Homo sapiens (human) hsa-miR-152-3p
  14. Ictidomys tridecemlineatus (thirteen-lined ground squirrel) microRNA miR-152
  15. Macaca mulatta mml-miR-152-3p
  16. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-148-P3_3p (mature (guide))
  17. Mus musculus (house mouse) mmu-miR-152-3p
  18. Notamacropus eugenii (tammar wallaby) Neu-Mir-148-P3_3p (mature (co-guide))
  19. Oryctolagus cuniculus ocu-miR-152-3p
  20. Ovis aries oar-miR-152
  21. Pan troglodytes ptr-miR-152
  22. Pongo abelii (Sumatran orangutan) Pab-Mir-148-P3_3p (mature (guide))
  23. Pongo pygmaeus ppy-miR-152
  24. Pteropus alecto (black flying fox) pal-miR-152-3p
  25. Rattus norvegicus rno-miR-152-3p
  26. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-148-P3_3p (mature (guide))
  27. Sphenodon punctatus Spt-Mir-148-P3_3p (mature (guide))
  28. Tupaia belangeri chinensis tch-miR-152
Relationships

Molecular Relationships

Publications