Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-212 precursor URS00003AD7BA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR212: MIR212 is a microRNA that has been studied for its effects on the proliferation and apoptosis of ovarian cancer (OC) cell lines [PMC6995389]. In a meta-analysis of Series 1 6 and 10-month data, as well as human BA9 data, eight microRNAs (Mir615, Mir135b, MIR212, Mir132, Mir20a, Mir708, Mir99a, Mir138-2) were found to be significantly associated with CAG length [PMC5764268]. These microRNAs passed the p-value threshold of 0.05 and had a false discovery rate (FDR) less than 0.05 [PMC5764268]. The specific role of MIR212 in this association was not mentioned in the given context. However, it is worth noting that MIR212 has been previously implicated in various biological processes and diseases. For example, it has been shown to be involved in the regulation of cell proliferation and apoptosis in different cancer types [PMC6995389]. Additionally, MIR212 has been associated with neurodegenerative diseases such as Alzheimer's disease [PMC5764268]. Further research is needed to fully understand the role of MIR212 in OC cell lines and its association with CAG length.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications