v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-21a-5p URS000039ED8D_10090

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAGCUUAUCAGACUGAUGUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Anolis carolinensis (green anole) aca-miR-21-5p
  2. Ateles geoffroyi (black-handed spider monkey) age-miR-21
  3. Bos taurus microRNA miR-21
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-21
  5. Canis lupus familiaris cfa-miR-21
  6. Capra hircus (goat) miR-21
  7. Chrysemys picta cpi-miR-21-5p
  8. Columba livia (rock pigeon) cli-miR-21-5p
  9. Cricetulus griseus (Chinese hamster) cgr-miR-21-5p
  10. Equus caballus eca-miR-21
  11. Gallus gallus gga-miR-21-5p
  12. Gorilla gorilla gorilla ggo-miR-21 (MIR21)
  13. Gorilla gorilla ggo-miR-21
  14. Homo sapiens (human) hsa-miR-21-5p
  15. Macaca mulatta (Rhesus monkey) mml-miR-21-5p
  16. Macaca nemestrina (pig-tailed macaque) mne-miR-21
  17. Monodelphis domestica mdo-miR-21-5p
  18. Ophiophagus hannah oha-miR-21-5p
  19. Ornithorhynchus anatinus (platypus) oan-miR-21-5p
  20. Ovis aries microRNA miR-21
  21. Pan paniscus ppa-miR-21
  22. Pan troglodytes (chimpanzee) ptr-miR-21
  23. Pongo pygmaeus (Bornean orangutan) ppy-miR-21
  24. Pteropus alecto (black flying fox) pal-miR-21-5p
  25. Rattus norvegicus (Norway rat) rno-miR-21-5p
  26. Sus scrofa ssc-miR-21-5p
  27. Taeniopygia guttata tgu-miR-21-5p
  28. Tupaia belangeri chinensis (Chinese tree shrew) tch-miR-21-5p
  29. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2544792
 Relationships

Molecular Relationships

 GoFlow Results Publications