v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Caenorhabditis elegans cel-miR-1-3p URS0000348947_6239

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGAAUGUAAAGAAGUAUGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Ascaris suum asu-miR-1-3p
  2. Caenorhabditis brenneri cbn-miR-1
  3. Caenorhabditis briggsae cbr-miR-1
  4. Callorhinchus milii (elephant shark) cmi-miR-1-3
  5. Canis lupus familiaris (dog) cfa-miR-1
  6. Danio rerio (zebrafish) microRNA miR-1
  7. Gallus gallus gga-miR-1a-3p
  8. Gorilla gorilla gorilla ggo-miR-1 (MIR1)
  9. Gorilla gorilla (western gorilla) ggo-miR-1
  10. Heligmosomoides polygyrus hpo-miR-1-3p
  11. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-34030223
  12. Oryzias latipes ola-miR-1-3p
  13. Ovis aries Pri-miR1.2
  14. Pan paniscus (pygmy chimpanzee) ppa-miR-1
  15. Pan troglodytes (chimpanzee) microRNA miR-1-2
  16. Python bivittatus pbv-miR-1a-3p
  17. Scyliorhinus torazame (cloudy catshark) Sto-Mir-1-P4_3p (mature (guide))
  18. Sus scrofa ssc-miR-1
  19. Xenopus tropicalis (tropical clawed frog) xtr-miR-1a
 Relationships

Molecular Relationships

 GoFlow Results Publications