Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-3474 URS00003256E0_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-3474: mmu-mir-3474 is a microRNA that was found to be downregulated in response to high glucose (HG) stimulation in a study that identified specific alterations in microRNA expression [PMC7667287]. This particular microRNA has 378 potential target genes, indicating its potential involvement in a wide range of cellular processes [PMC7667287]. The downregulation of mmu-mir-3474 was consistent across different assessments, confirming its response to HG conditions [PMC7667287]. Additionally, mmu-mir-3474 is part of the mmu_circRNA_21040 related network, which includes 14 target miRNAs and 36 genes, suggesting its role in complex regulatory interactions [PMC9574125]. Furthermore, mmu-mir-3474 is also related to DARPP-32, a protein associated with dopaminergic neurotransmission and signal transduction pathways; this relationship was identified through the analysis of mouse-derived microRNAs using "TargetScanHuman" [PMC10132208]. The study utilized TaqMan MicroRNA Assays for accurate measurement and validation of miRNA expression levels including that of mmu-mir-3474 [PMC8007565].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUGGGAGGAGACGUGGAUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications