Taeniopygia guttata (zebra finch) tgu-miR-29a-3p URS000030B2CE_59729

• 21 nucleotides
• 2 databases (MIRBASE, RefSeq)
• Found in 12 other species
• 4 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

mRNA interactions total

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAGCACCAUUUGAAAUCGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

1. Anolis carolinensis aca-miR-29a-3p
2. Callithrix jacchus cja-miR-29c
3. Callorhinchus milii (elephant shark) Cmi-Mir-29-P2a-v1_3p (mature (guide))
4. Cricetulus griseus cgr-miR-29c-3p
5. Gallus gallus gga-miR-29a-3p
6. Monodelphis domestica mdo-miR-29a-3p
7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-8189236
8. Ornithorhynchus anatinus oan-miR-29a-3p
9. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-63151
10. Tupaia belangeri chinensis tch-miR-29c-3p
11. Tursiops truncatus (common bottlenose dolphin) miR-29c
12. Xenopus tropicalis xtr-miR-29a

Relationships

Molecular Relationships

Publications Download

• FASTA
• JSON