Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-95-3p URS00002E2DE7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-95: Hsa-mir-95 is a microRNA (miRNA) that has been identified as differentially expressed in various tissue types and disease states, indicating its potential role in cellular processes and disease pathogenesis [PMC9987318]. It is one of the miRNAs that exhibited considerable differential expression in both periapical and pulp tissues, suggesting its involvement in oral health or disease [PMC9987318]. Furthermore, hsa-mir-95 has been associated with type 2 diabetes mellitus (T2DM) through its target genes, highlighting a possible link with metabolic disorders [PMC10126023]. In the context of diabetic nephropathy (DN), hsa-mir-95 was among the miRNAs differentially expressed in kidney tissues when comparing healthy individuals to DN patients [PMC8616647]. Additionally, it was differentially expressed when comparing pancreatic neuroendocrine tumors (PNETs) to pancreatic ductal adenocarcinomas (PDACs), suggesting a role in pancreatic cancer biology [PMC7352720]. The potential of hsa-mir-95-containing extracellular vesicles (EVs) for regenerative medicine has also been noted due to their association with cellular proliferation and apoptosis inhibition [PMC10126023]. However, it was also identified as one of the miRNAs not previously detected as differentially expressed during control myogenesis, indicating a unique expression pattern under certain physiological conditions [PMC4186784].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAACGGGUAUUUAUUGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Relationships

Molecular Relationships

GoFlow Results Publications