v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-125b-1-3p URS00002DABEA_9606

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACGGGUUAGGCUCUUGGGAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 31 other species

  1. Alligator mississippiensis (American alligator) ami-miR-125b-3p
  2. Anolis carolinensis (green anole) Aca-Mir-10-P3d_3p* (star (passenger))
  3. Bos taurus (domestic cattle) Bta-Mir-10-P3d_3p* (star (passenger))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-10-P3d_3p* (star (passenger))
  5. Canis lupus familiaris (dog) Cfa-Mir-10-P3d_3p* (star (passenger))
  6. Cavia porcellus cpo-miR-125b-3p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-10-P3d_3p* (star (passenger))
  8. Columba livia (rock pigeon) cli-miR-125-3p
  9. Dasypus novemcinctus (nine-banded armadillo) dno-miR-125b-3p
  10. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P3d_3p* (star (passenger))
  11. Eptesicus fuscus (big brown bat) efu-miR-125a
  12. Equus caballus (horse) Eca-Mir-10-P3d_3p* (star (passenger))
  13. Gallus gallus (chicken) Gga-Mir-10-P3d_3p* (star (passenger))
  14. Gekko japonicus Gja-Mir-10-P3d_3p* (star (passenger))
  15. Latimeria chalumnae (coelacanth) Lch-Mir-10-P3d_3p* (star (passenger))
  16. Lepisosteus oculatus (spotted gar) Loc-Mir-10-P3d_3p* (star (passenger))
  17. Loxodonta africana (African savanna elephant) Laf-Mir-10-P3d_3p* (star (passenger))
  18. Macaca mulatta (Rhesus monkey) mml-miR-125b-1-3p
  19. Microcebus murinus (gray mouse lemur) Mmr-Mir-10-P3d_3p* (star (passenger))
  20. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-10-P3d_3p* (star (passenger))
  21. Monopterus albus (swamp eel) Mal-Mir-10-P3d1_3p* (star (passenger))
  22. Mus musculus mmu-miR-125b-1-3p
  23. Ophiophagus hannah oha-miR-125b-3p
  24. Oryctolagus cuniculus ocu-miR-125b-3p
  25. Pongo abelii (Sumatran orangutan) Pab-Mir-10-P3d_3p* (star (passenger))
  26. Rattus norvegicus (Norway rat) rno-miR-125b-1-3p
  27. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-10-P3d_3p* (star (passenger))
  28. Scyliorhinus torazame (cloudy catshark) Sto-Mir-10-P3d_3p* (star (passenger))
  29. Taeniopygia guttata (zebra finch) Tgu-Mir-10-P3d_3p* (star (passenger))
  30. Xenopus laevis (African clawed frog) Xla-Mir-10-P3d4_3p* (star (passenger))
  31. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-10-P3d_3p* (star (passenger))
 Relationships

Molecular Relationships

 Publications