Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-214-3p URS00002C11C3_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-214: mmu-mir-214 is a microRNA (miRNA) expressed in mice, which plays a role in various cellular processes, including the regulation of the cytoskeletal actin architecture [PMC9379403]. The expression of mmu-mir-214 has been observed to be highly elevated in infected liver cells, suggesting its potential involvement in the body's response to infection [PMC9861972]. Furthermore, mmu-mir-214 has been implicated in liver fibrogenesis, with its up-regulation observed in hepatic stellate cells during late infection stages of S. japonicum, indicating a possible target for anti-fibrosis therapy [PMC3692539]. Additionally, mmu-mir-214 has been predicted to bind multiple sites within the 3′UTR of target mRNAs and is differentially expressed under various conditions according to multiple reports [PMC4902921], [PMC2923610]. The modulation of miR-214 levels can be achieved through transfection with specific miRNA mimics or inhibitors, which can have significant effects on cellular functions and gene expression regulation [PMC5855744].

mRNA interactions total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACAGCAGGCACAGACAGGCAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Alligator mississippiensis Ami-Mir-214-v1_3p (mature (guide))
  2. Anolis carolinensis aca-miR-214-3p
  3. Artibeus jamaicensis (Jamaican fruit-eating bat) aja-miR-214
  4. Bos taurus (domestic cattle) bta-miR-214
  5. Callithrix jacchus cja-miR-214
  6. Callorhinchus milii Cmi-Mir-214-v1_3p (mature (guide))
  7. Canis lupus familiaris cfa-miR-214
  8. Cavia porcellus cpo-miR-214-3p
  9. Cervus elaphus cel-miR-214
  10. Chrysemys picta bellii (western painted turtle) Cpi-Mir-214-v1_3p (mature (guide))
  11. Columba livia (rock pigeon) cli-miR-214-3p
  12. Dasypus novemcinctus dno-miR-214-3p
  13. Daubentonia madagascariensis dma-miR-214
  14. Echinops telfairi Ete-Mir-214-v1_3p (mature (guide))
  15. Equus caballus eca-miR-214
  16. Gallus gallus (chicken) Gga-Mir-214-v1_3p (mature (guide))
  17. Gekko japonicus Gja-Mir-214-v1_3p (mature (guide))
  18. Homo sapiens (human) hsa-miR-214-3p
  19. Latimeria chalumnae (coelacanth) Lch-Mir-214_3p (mature (guide))
  20. Macaca mulatta (Rhesus monkey) Mml-Mir-214-v1_3p (mature (guide))
  21. Microcaecilia unicolor Mun-Mir-214_3p (mature (co-guide))
  22. Microcebus murinus (gray mouse lemur) mmr-miR-214
  23. Monodelphis domestica Mdo-Mir-214-v1_3p (mature (guide))
  24. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-214
  25. Ornithorhynchus anatinus (platypus) oan-miR-214-3p
  26. Oryctolagus cuniculus ocu-miR-214-3p
  27. Otolemur garnettii (small-eared galago) oga-miR-214
  28. Papio hamadryas pha-miR-214
  29. Pteropus alecto pal-miR-214-3p
  30. Python bivittatus (Burmese python) pbv-miR-214-3p
  31. Rattus norvegicus (Norway rat) Rno-Mir-214-v1_3p (mature (guide))
  32. Sarcophilus harrisii Sha-Mir-214-v1_3p (mature (guide))
  33. Scyliorhinus torazame (cloudy catshark) Sto-Mir-214-v1_3p (mature (guide))
  34. Sphenodon punctatus (tuatara) Spt-Mir-214_3p (mature (guide))
  35. Taeniopygia guttata (zebra finch) tgu-miR-214-3p
  36. Tursiops truncatus miR-214
  37. Xenopus laevis (African clawed frog) Xla-Mir-214-P3-v1_3p (mature (guide))
  38. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-214-v1_3p (mature (guide))
Relationships

Molecular Relationships

GoFlow Results Publications