mmu-mir-20b: Mmu-mir-20b is a member of the miR-17 microRNA precursor family and is expressed in the embryonic hearts of various organisms, including zebrafish, rat, and mouse [PMC4405592]. Bioinformatics analysis has identified Bambi as a potential target gene of mmu-mir-20b [PMC4405592]. The mature sequence of mmu-mir-20b is CAAAGTGCTCATAGTGCAGGTAG [PMC4405592]. In a study using P19 cells, the overexpression and silencing vectors of mmu-mir-20b were transfected to observe GFP expression under a fluorescence microscope [PMC4405592]. A stable P19 mmu-mir-20b overexpression line and a stable miR-20b silenced cell line were constructed for further analysis [PMC4405592]. Additionally, mmu-mir-20b has been identified as one of the miRNAs potentially targeting PXN during the progression of a model [PMC3030602]. In murine retrovirus-induced T-cell lymphomas with retroviral integration within the mir-106a-363 locus, higher expression levels of mmu-mir-20b were observed compared to lymphomas without integration in this locus [PMC7290785]. Furthermore, this locus contains other miRNAs such as mmu-miR-106a, mmu-miR19b-2, and mmu-miR92a. The expression levels of various miRNAs including mmu-miR20a3p, -5p, -106a5p and -mir 20b were assessed in another study using murine cells [PMC7069219]. Finally, to investigate the effect on FGF2 and GRB2 expressions in 661w cells after transfection with mmu mir-20b mimic or inhibitor, mRNA and protein expression levels were detected [PMC6834413].