v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays (maize) zma-miR399a-3p URS000028246C_4577

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCCAAAGGAGAAUUGCCCUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Aegilops tauschii ata-miR399a-3p
  2. Ananas comosus microRNA 399j
  3. Brachypodium distachyon bdi-miR399c
  4. Citrus sinensis csi-miR399c-3p
  5. Glycine max (soybean) gma-miR399i
  6. Linum usitatissimum (flax) lus-miR399b
  7. Malus domestica (apple) mdm-miR399c
  8. Manihot esculenta (cassava) mes-miR399a
  9. Moringa oleifera (horseradish tree) novel_miR_146
  10. Oryza sativa (Asian cultivated rice) osa-miR399a
  11. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR399b
  12. Populus tomentosa Pto-miR399f
  13. Populus trichocarpa (black cottonwood) ptc-miR399f
  14. Sorghum bicolor (sorghum) sbi-miR399j
  15. Theobroma cacao tcc-miR399g
  16. Vigna unguiculata vun-miR399b
  17. Vitis vinifera (wine grape) vvi-miR399a
 Relationships

Molecular Relationships