Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-134-5p URS0000272A92_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-134: Mmu-mir-134 is a microRNA that has been observed to significantly increase its expression in liver cells post-infection, suggesting a role in the host's response to infection [PMC9861972]. This miRNA has been implicated in the regulation of genes associated with pluripotency, such as Nanog and Sox2, indicating its involvement in cell differentiation [PMC9505168]. Functional studies have employed mmu-mir-134 mimics and inhibitors to elucidate its role, with evidence suggesting that mmu-mir-134 can directly bind to the 3'UTR of target genes like BDNF [PMC9120625]. Additionally, mmu-mir-134 is associated with pathways such as 'Mitotic Roles of Polo-Like-Kinase' and has been linked to a large number of negatively delayed mRNAs [PMC5220332]. It is also recognized as a degrader of transcription factors like Oct4 and Nanog [PMC3937077]. In the context of neurodegenerative diseases like Alzheimer's disease (AD), mmu-mir-134 is involved in regulating the development of cortical neurons and may have implications for disease progression [PMC6906698]. Quantitative PCR assays using specific primers for mmu-mir-134 have been employed for its detection and quantification in various studies [PMC9092865], highlighting its significance in both physiological and pathological processes.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGACUGGUUGACCAGAGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-134
  2. Canis lupus familiaris cfa-miR-134
  3. Capra hircus chi-miR-134
  4. Cavia porcellus cpo-miR-134-5p
  5. Cricetulus griseus cgr-miR-134
  6. Equus caballus (horse) eca-miR-134
  7. Homo sapiens hsa-miR-134-5p
  8. Macaca mulatta (Rhesus monkey) mml-miR-134-5p
  9. Microcebus murinus (gray mouse lemur) Mmr-Mir-134_5p (mature (guide))
  10. Pan troglodytes (chimpanzee) ptr-miR-134
  11. Pongo abelii (Sumatran orangutan) Pab-Mir-134_5p (mature (guide))
  12. Rattus norvegicus rno-miR-134-5p
Relationships

Molecular Relationships

Publications