v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) hsa-miR-29b-3p secondary structure diagram

Homo sapiens (human) hsa-miR-29b-3p URS000024463E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-29: Hsa-miR-29 is a member of the microRNA family, which plays a crucial role in gene regulation [PMC8086068]. Research has highlighted the interaction between hsa-miR-29 family members and gene expression, particularly noting a significant inverse relationship between hsa-miR-29 and DNMT3A/B mRNA levels in lung tumors [PMC8086068]. This anti-correlation has been observed in breast tumors as well, suggesting a broader regulatory role of hsa-miR-29 in cancer [PMC8086068]. Additionally, studies have identified regulatory associations between other microRNAs such as hsa-miR-142-5p and the gene CD24, although this is not directly related to hsa-miR-29 [PMC5370447].

mRNA interactions total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAGCACCAUUUGAAAUCAGUGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 48 other species

  1. Alligator mississippiensis Ami-Mir-29-P1b-v1_3p (mature (guide))
  2. Anolis carolinensis (green anole) Aca-Mir-29-P1d-v1_3p (mature (guide))
  3. Artibeus jamaicensis aja-miR-29b
  4. Bos taurus (domestic cattle) bta-miR-29b
  5. Callithrix jacchus cja-miR-29b
  6. Callorhinchus milii (elephant shark) Cmi-Mir-29-P1b_3p (mature (guide))
  7. Canis lupus familiaris (dog) cfa-miR-29b
  8. Cavia porcellus cpo-miR-29b-3p
  9. Chrysemys picta bellii Cpi-Mir-29-P1b-v1_3p (mature (guide))
  10. Columba livia (rock pigeon) cli-miR-29b-3p
  11. Cricetulus griseus cgr-miR-29b-3p
  12. Cyprinus carpio ccr-miR-29b
  13. Danio rerio (zebrafish) dre-miR-29b3-3p
  14. Dasypus novemcinctus dno-miR-29b-3p
  15. Echinops telfairi Ete-Mir-29-P1b-v1_3p (mature (guide))
  16. Equus caballus eca-miR-29b
  17. Gallus gallus (chicken) gga-miR-29b-3p
  18. Gekko japonicus Gja-Mir-29-P1b-v1_3p (mature (guide))
  19. Latimeria chalumnae Lch-Mir-29-P1b_3p (mature (guide))
  20. Lepisosteus oculatus Loc-Mir-29-P1b-v1_3p (mature (guide))
  21. Loxodonta africana (African savanna elephant) Laf-Mir-29-P1b-v1_3p (mature (guide))
  22. Macaca mulatta (Rhesus monkey) mml-miR-29b-3p
  23. Maylandia zebra (zebra mbuna) mze-miR-29b
  24. Microcaecilia unicolor Mun-Mir-29-P1d-v1_3p (mature (guide))
  25. Microcebus murinus mmr-miR-29b
  26. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-29-P1b-v1_3p (mature (guide))
  27. Monopterus albus Mal-Mir-29-P1d2-v1_3p (mature (guide))
  28. Mus musculus mmu-miR-29b-3p
  29. Neolamprologus brichardi (lyretail cichlid) nbr-miR-29b
  30. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-29b
  31. Notamacropus eugenii (tammar wallaby) Neu-Mir-29-P1b-v1_3p (mature (guide))
  32. Ophiophagus hannah oha-miR-29b-3p
  33. Ornithorhynchus anatinus (platypus) Oan-Mir-29-P1b-v1_3p (mature (guide))
  34. Oryctolagus cuniculus (rabbit) ocu-miR-29b-3p
  35. Otolemur garnettii (small-eared galago) oga-miR-29b
  36. Pongo abelii (Sumatran orangutan) Pab-Mir-29-P1d-v1_3p (mature (guide))
  37. Pteropus alecto pal-miR-29b-3p
  38. Python bivittatus Pbv-Mir-29-P1d-v1_3p (mature (guide))
  39. Rattus norvegicus (Norway rat) rno-miR-29b-3p
  40. Saccoglossus kowalevskii Sko-Mir-29-P1_3p (mature (guide))
  41. Sarcophilus harrisii Sha-Mir-29-P1b-v1_3p (mature (guide))
  42. Scyliorhinus torazame Sto-Mir-29-P1d_3p (mature (guide))
  43. Sphenodon punctatus (tuatara) Spt-Mir-29-P1b_3p (mature (guide))
  44. Sus scrofa ssc-miR-29b
  45. Taeniopygia guttata Tgu-Mir-29-P1b-v1_3p (mature (guide))
  46. Tupaia belangeri chinensis tch-miR-29b-3p
  47. Xenopus laevis (African clawed frog) xla-miR-29b-3p
  48. Xenopus tropicalis (tropical clawed frog) xtr-miR-29b
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 GoFlow Results Publications