Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Salmo salar (Atlantic salmon) ssa-miR-107-3p URS0000241F6A_8030

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCAGCAUUGUACAGGGCUAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Anolis carolinensis aca-miR-107-3p
  2. Bos taurus bta-miR-107
  3. Chiloscyllium plagiosum microRNA cpl-miR-107
  4. Cricetulus griseus (Chinese hamster) cgr-miR-107
  5. Cyprinus carpio ccr-miR-107
  6. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-107
  7. Ictalurus punctatus (channel catfish) ipu-miR-107a
  8. Maylandia zebra mze-miR-107
  9. Mus musculus Mus_musculus piRNA piR-mmu-72623
  10. Neolamprologus brichardi (lyretail cichlid) nbr-miR-107
  11. Oreochromis niloticus (Nile tilapia) oni-miR-107
  12. Ornithorhynchus anatinus oan-miR-107-3p
  13. Ovis aries (sheep) oar-miR-107
  14. Pundamilia nyererei pny-miR-107
  15. Python bivittatus (Burmese python) pbv-miR-107-3p
  16. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3162641
Publications