Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla ggo-miR-153 (MIR153) URS000022A692_9595

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGCAUAGUCACAAAAGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

  1. Canis lupus familiaris cfa-miR-153
  2. Chrysemys picta cpi-miR-153-3p
  3. Gallus gallus (chicken) gga-miR-153-3p
  4. Gorilla gorilla ggo-miR-153
  5. Macaca mulatta mml-miR-153-3p
  6. Macaca nemestrina (pig-tailed macaque) mne-miR-153
  7. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-48725510
  8. Pongo pygmaeus microRNA mir-153-1
  9. Sus scrofa (pig) ssc-miR-153
  10. Xenopus tropicalis xtr-miR-153
Publications