v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-99a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-99a precursor URS0000208A34_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir99a: MIR99A is a microRNA that has been identified as a regulator of NOX4 expression by targeting the 3’-UTR [PMC7407884]. This microRNA is notably one of the most elevated plasma miRNAs in community-acquired pneumonia (CAP), suggesting its potential role in the pathophysiology or as a biomarker for this condition [PMC8358855].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGGACCGCACAAGCUCGCUUCUAUGGGUCUGUGUCAGUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 23 other species

  1. Aotus nancymaae microRNA 99a (ENSANAG00000003299.1)
  2. Bos taurus microRNA bta-mir-99a precursor
  3. Capra hircus microRNA chi-mir-99a precursor
  4. Cebus imitator microRNA 99a (ENSCCAG00000005482.1)
  5. Cercocebus atys (Sooty mangabey) microRNA 99a (ENSCATG00000012016.1)
  6. Chlorocebus sabaeus microRNA 99a (ENSCSAG00000027484.1)
  7. Gorilla gorilla gorilla ggo-mir-99a (ENSGGOG00000032928.2)
  8. Gorilla gorilla microRNA ggo-mir-99a precursor
  9. Lagothrix lagotricha (brown woolly monkey) microRNA lla-mir-99a precursor
  10. Macaca mulatta (Rhesus monkey) microRNA mml-mir-99a precursor
  11. Macaca nemestrina microRNA mne-mir-99a precursor
  12. Mandrillus leucophaeus (Drill) microRNA 99a (ENSMLEG00000023489.1)
  13. Myotis lucifugus (little brown bat) microRNA 99a (ENSMLUG00000017820.1)
  14. Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 99a (ENSNLEG00000026317.2)
  15. Otolemur garnettii (small-eared galago) microRNA 99a (ENSOGAG00000017500.1)
  16. Ovis aries (sheep) microRNA oar-mir-99a precursor
  17. Pan paniscus microRNA ppa-mir-99a precursor
  18. Pan troglodytes (chimpanzee) microRNA ptr-mir-99a precursor
  19. Pteropus vampyrus miRNA (ENSPVAG00000027869.1)
  20. Rhinopithecus bieti microRNA 99a (ENSRBIG00000018700.1)
  21. Rhinopithecus roxellana microRNA 99a (ENSRROG00000018052.1)
  22. Saimiri boliviensis boliviensis microRNA 99a (ENSSBOG00000016104.1)
  23. Vicugna pacos (alpaca) miRNA (ENSVPAG00000015619.1)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Expression GoFlow Results Publications