Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1271-3p URS00001D4A78_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1271: Hsa-mir-1271 is a microRNA (miRNA) identified as unique to the platelet-derived fraction and is implicated in various biological processes and diseases [PMC3281076]. It has been found to target ATG16L, a gene associated with autophagy and inflammatory bowel disease (IBD) susceptibility [PMC3281076]. In the context of acute myocardial infarction (AMI) and healthy controls, hsa-mir-1271 is among the miRNAs with downregulated expression [PMC8923688]. It is pancreas-specific and targets the CTSB gene, which has non-coding variants [PMC6778667]. Hsa-mir-1271 also plays a role in cancer, where it is associated with resistance to cisplatin treatment [PMC8206191] and can influence the expression of CASP9, a gene involved in apoptosis, when silenced in cell cultures treated with salinomycin [PMC8206191]. Its expression levels fluctuate under salinomycin treatment, suggesting its role in cellular response mechanisms to chemotherapy [PMC8206191]. Additionally, hsa-mir-1271 has been identified as a potential diagnostic biomarker for malignant pleural mesothelioma (MPM), given its involvement in p38-related pathways which are crucial for tumorigenesis [PMC4464514].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUGCCUGCUAUGUGCCAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications