Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-211-5p URS00001A3555_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-204: Hsa-mir-204 is a microRNA implicated in various cellular processes and diseases, including cancer. It has been observed to be downregulated in inflammatory breast cancer (IBC) patients, which is expected to result in increased levels of HMGA2, a transcriptional regulator [PMC4289319]. This microRNA also plays a role in clear cell renal cell carcinoma (ccRCC) development by potentially regulating the focal adhesion pathway [PMC7405617]. Furthermore, hsa-mir-204 downregulation has been associated with breast cancer susceptibility gene (BRCA) mutations and can be an indicator of overall survival in patients [PMC9918521]. In endometrial carcinoma cells, hsa-mir-204 has been shown to inhibit clonogenic growth, migration, and invasion through in vitro functional analyses [PMC4918724]. The assessment of hsa-mir-204 levels can be performed using TaqMan MicroRNA Assays [PMC4508825]. Additionally, hsa-mir-204 expression has been identified in various stages of intestinal type gastric cancer and is associated with specific tumor stages such as T4N1M0 [PMC4496000].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCCCUUUGUCAUCCUUCGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Relationships New

Molecular Relationships

GoFlow Results Publications