Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays (maize) zma-miR164a-5p URS00001A00F8_4577

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

zma-mir164a-5p: Zma-mir164a-5p is a plant-derived microRNA that has been shown to be absorbed from the diet and is capable of targeting specific porcine genes, such as CSPG4, OTX1, and PLAGL2 [PMC7502231]. This miRNA has been identified to bind to the porcine target genes through a dual-luciferase assay, which demonstrated the interaction between zma-mir164a-5p and its potential target genes [PMC5428504]. With 50 potential porcine mRNA targets predicted for zma-mir164a-5p based on low minimum free energy and high seed region match, it suggests a functional role similar to endogenous miRNAs within porcine cells [PMC5428504]. The miR-TRAP approach further supports that zma-mir164a-5p targets its predicted genes in the Argonaute/RISC complex in pigs [PMC5428504]. Quantitative RT-PCR analysis of 15 potential targets showed that 73.33% had significantly increased transcripts upon zma-mir164a-5p treatment, indicating effective targeting [PMC5428504]. The maize-derived miRNAs were confirmed as bona fide plant miRNAs based on their resistance to periodate oxidation and their similar abundance to synthetic 2′-O-methylated miRNAs [PMC5428504]. The functional impact of zma-mir164a-5p on its target genes was further confirmed by reduced luciferase activity in cells transfected with wild-type target gene constructs compared with mutant types [PMC5428504].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGAGAAGCAGGGCACGUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Aegilops tauschii ata-miR164b-5p
  2. Amborella trichopoda atr-miR164b
  3. Ananas comosus (pineapple) vvi-miR164c
  4. Arabidopsis lyrata (lyrate rockcress) aly-miR164b-5p
  5. Arabidopsis thaliana (thale cress) ath-miR164a
  6. Asparagus officinalis aof-miR164
  7. Brachypodium distachyon (stiff brome) bdi-miR164e
  8. Brassica napus bna-miR164a
  9. Brassica rapa bra-miR164a
  10. Cabomba aquatica miR164
  11. Camelina sativa (false flax) cas-miR164
  12. Carica papaya cpa-miR164c
  13. Citrus sinensis (sweet orange) csi-miR164c-5p
  14. Citrus trifoliata (trifoliate orange) ctr-miR164
  15. Corchorus capsularis (jute) sRNA CCACVL1_09489
  16. Corchorus olitorius aly-miR164a-
  17. Cucumis melo (muskmelon) cme-miR164c
  18. Cynara cardunculus var. scolymus cca-miR164b
  19. Fragaria vesca subsp. vesca fve-miR164a-5p
  20. Glycine max gma-miR164f
  21. Gossypium hirsutum (cotton) ghr-miR164
  22. Hevea brasiliensis partial microRNA 164c
  23. Linum usitatissimum lus-miR164c
  24. Malus domestica (apple) mdm-miR164c
  25. Manihot esculenta mes-miR164c
  26. Medicago truncatula (barrel medic) mtr-miR164c
  27. Nicotiana tabacum nta-miR164b
  28. Oryza sativa (Asian cultivated rice) osa-miR164f
  29. Oryza sativa Japonica Group microRNA osa-miR164b
  30. Populus deltoides pde-miR164e-5p
  31. Populus tomentosa Pto-miR164d
  32. Populus tremula x Populus alba Pta-MIR164e
  33. Populus trichocarpa ptc-miR164d
  34. Prunus persica ppe-miR164a
  35. Ricinus communis (castor bean) rco-miR164a
  36. Rosa chinensis ath-miR164a
  37. Salvia sclarea ssl-miR164b
  38. Solanum lycopersicum sly-miR164b-5p
  39. Sorghum bicolor sbi-miR164e
  40. Theobroma cacao (cacao) tcc-miR164b
  41. Triticum aestivum (bread wheat) tae-miR164
  42. Vitis vinifera vvi-miR164c
Relationships

Molecular Relationships

Publications