Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Hippoglossus hippoglossus (Atlantic halibut) hhi-miR-21 URS00001844D3_8267

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCUUAUCAGACUGGUGUUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Callorhinchus milii (elephant shark) Cmi-Mir-21_5p (mature (guide))
  2. Cyprinus carpio (common carp) ccr-miR-21
  3. Danio rerio (zebrafish) dre-miR-21
  4. Gadus morhua (Atlantic cod) Gmo-Mir-21-P1_5p (mature (guide))
  5. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-21
  6. Ictalurus punctatus (channel catfish) ipu-miR-21
  7. Latimeria chalumnae Lch-Mir-21_5p (mature (guide))
  8. Lepisosteus oculatus (spotted gar) Loc-Mir-21_5p (mature (guide))
  9. Maylandia zebra (zebra mbuna) mze-miR-21
  10. Monopterus albus (swamp eel) Mal-Mir-21-P1_5p (mature (guide))
  11. Neolamprologus brichardi (lyretail cichlid) nbr-miR-21
  12. Oreochromis niloticus oni-miR-21
  13. Pundamilia nyererei pny-miR-21
  14. Salmo salar (Atlantic salmon) ssa-miR-21b-5p
  15. Scyliorhinus torazame Sto-Mir-21_5p (mature (guide))
  16. Takifugu rubripes fru-miR-21
  17. Tetraodon nigroviridis tni-miR-21
  18. Tor tambroides miR-21