Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-95 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-95 precursor URS000015F70F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir95: MIR95 is a microRNA (miRNA) that has been identified as having an oncogenic function, with high expression levels in prostate and lung cancers [PMC5302951]. It is also differentially expressed in patients with primary myelofibrosis and has been associated with immune tolerance in liver transplant recipients, suggesting a role in immune regulation [PMC6183594; PMC7412931]. In regulatory T cells (Tregs), MIR95 is upregulated, indicating its potential involvement in Treg function [PMC7154970]. MIR95 has been identified as a candidate biomarker for liver transplant tolerance, highlighting its potential clinical relevance [PMC8376267]. It also appears to play a role in myogenic differentiation and may act as a disease modifier in facioscapulohumeral muscular dystrophy (FSHD) due to its interaction with specific binding sites that can be disrupted by genetic variants [PMC6969370]. In skeletal muscle, MIR95 expression levels are associated with muscle mass regulation [PMC6812755]. Additionally, MIR95 has been implicated in the modulation of apoptosis and radioresistance of cancer cells, suggesting its involvement in cancer cell survival mechanisms [PMC6525830; PMC3849454]. Research on the genomic organization and sequence conservation of MIR95 suggests that it may interact with numerous target mRNAs, further indicating its biological significance across different cellular processes [PMC3874173].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACACAGUGGGCACUCAAUAAAUGUCUGUUGAAUUGAAAUGCGUUACAUUCAACGGGUAUUUAUUGAGCACCCACUCUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 22 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression Publications