Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-21a-3p URS000015930E_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-21a: mmu-mir-21a, a microRNA, has been shown to play a significant role in the regulation of decidual cell function in mice by targeting the 3′-UTR of the Programmed cell death 4 (Pdcd4) gene [PMC8099688]. The expression of mmu-mir-21a is upregulated in decidualized cells, and its mimicry leads to a reduction in Pdcd4 expression by approximately 33.1%, suggesting an inhibitory role [PMC8099688]. The seed sequence of mmu-mir-21a is highly conserved across mammalian species, and its targeting sites on Pdcd4 mRNA have been predicted using TargetScan databases [PMC8099688]. Inhibition of mmu-mir-21a results in increased Pdcd4 protein levels and is associated with elevated apoptosis markers such as cleaved Caspase-3 and BAX/BCL2 ratio, indicating that mmu-mir-21a may function by inhibiting apoptosis in decidual cells [PMC8099688]. This microRNA's regulatory effect on Pdcd4 has implications for the maintenance and reconstruction of decidual tissues during pregnancy establishment [PMC8099688]. The study's findings underscore the importance of mmu-mir-21a as a key factor for pregnancy maintenance by modulating cell survival pathways through its interaction with Pdcd4 [PMC8099688].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAACAGCAGUCGAUGGGCUGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

Relationships

Molecular Relationships

Publications