Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-99a-5p URS0000157026_9606

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACCCGUAGAUCCGAUCUUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 56 other species

  1. Alligator mississippiensis (American alligator) ami-miR-99a-5p
  2. Anolis carolinensis aca-miR-99a-5p
  3. Bos taurus (domestic cattle) Bta-Mir-10-P2c_5p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-10-P2c_5p (mature (guide))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-10-P2c_5p (mature (guide))
  6. Canis lupus familiaris (dog) Cfa-Mir-10-P2c_5p (mature (guide))
  7. Capra hircus (goat) miR-99a
  8. Cavia porcellus cpo-miR-99a-5p
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-10-P2c_5p (mature (guide))
  10. Chrysemys picta cpi-miR-99a-5p
  11. Columba livia (rock pigeon) cli-miR-99-5p
  12. Danio rerio (zebrafish) dre-miR-99
  13. Dasypus novemcinctus dno-miR-99a-5p
  14. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-10-P2c_5p (mature (guide))
  15. Equus caballus eca-miR-99a
  16. Gadus morhua (Atlantic cod) gmo-miR-99-5p
  17. Gallus gallus gga-miR-99a-5p
  18. Gekko japonicus Gja-Mir-10-P2c_5p (mature (guide))
  19. Gorilla gorilla gorilla ggo-miR-99a (MIR99A)
  20. Gorilla gorilla (western gorilla) ggo-miR-99a
  21. Ictalurus punctatus ipu-miR-99a
  22. Lagothrix lagotricha (brown woolly monkey) lla-miR-99a
  23. Latimeria chalumnae Lch-Mir-10-P2c_5p (mature (guide))
  24. Lepisosteus oculatus Loc-Mir-10-P2c_5p (mature (guide))
  25. Loxodonta africana (African savanna elephant) Laf-Mir-10-P2c_5p (mature (guide))
  26. Macaca mulatta mml-miR-99a-5p
  27. Macaca nemestrina mne-miR-99a
  28. Maylandia zebra (zebra mbuna) mze-miR-99b
  29. Microcaecilia unicolor Mun-Mir-10-P2c_5p (mature (guide))
  30. Microcebus murinus mmr-miR-99a
  31. Monopterus albus Mal-Mir-10-P2c2_5p (mature (guide))
  32. Mus musculus (house mouse) mmu-miR-99a-5p
  33. Neolamprologus brichardi (lyretail cichlid) nbr-miR-99b
  34. Notamacropus eugenii (tammar wallaby) Neu-Mir-10-P2c_5p (mature (guide))
  35. Ophiophagus hannah oha-miR-99a-5p
  36. Oreochromis niloticus (Nile tilapia) oni-miR-99b
  37. Ornithorhynchus anatinus (platypus) Oan-Mir-10-P2c_5p (mature (guide))
  38. Oryctolagus cuniculus ocu-miR-99a-5p
  39. Ovis aries (sheep) miscellaneous RNA
  40. Pan paniscus ppa-miR-99a
  41. Pan troglodytes (chimpanzee) ptr-miR-99a
  42. Pongo abelii (Sumatran orangutan) Pab-Mir-10-P2c_5p (mature (guide))
  43. Pongo pygmaeus ppy-miR-99a
  44. Pundamilia nyererei pny-miR-99b
  45. Python bivittatus (Burmese python) Pbv-Mir-10-P2c_5p (mature (guide))
  46. Rattus norvegicus (Norway rat) rno-miR-99a-5p
  47. Salmo salar (Atlantic salmon) ssa-miR-99-5p
  48. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-10-P2c_5p (mature (guide))
  49. Scyliorhinus torazame Sto-Mir-10-P2c_5p (mature (guide))
  50. Sphenodon punctatus Spt-Mir-10-P2c_5p (mature (guide))
  51. Sus scrofa ssc-miR-99a-5p
  52. Taeniopygia guttata (zebra finch) Tgu-Mir-10-P2c_5p (mature (guide))
  53. Tor tambroides (Thai mahseer) miR-99
  54. Tupaia belangeri chinensis tch-miR-99a-5p
  55. Xenopus laevis Xla-Mir-10-P2c3_5p (mature (guide))
  56. Xenopus tropicalis (tropical clawed frog) xtr-miR-99
Relationships

Molecular Relationships