Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-29b precursor (hsa-mir-29b-1) secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-29b precursor (hsa-mir-29b-1) URS0000150A7D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mir29b1: MIR29B1 is a microRNA gene that encodes for the miR-29b-3p sequence, a member of the miR-29 family, which is implicated in various cellular processes and diseases [PMC9601486]. In the context of Alzheimer's disease (AD), MIR29B1 has been found to be downregulated in the cortex of AD patients, suggesting a potential role in the disease's pathogenesis [PMC7564652]. This downregulation may influence AD by targeting genes directly involved in its pathogenesis, such as BACE1, which is involved in amyloid precursor protein processing [PMC7564652]. Additionally, MIR29B1's downregulation could indirectly affect neuron survival and thus contribute to AD progression [PMC7564652]. In other studies, MIR29B1 has been associated with various biological processes; for instance, it has been implicated in increasing milk yield in dairy cattle when co-expressed with MIR148A [PMC6898964], and its upregulation was observed upon knockdown of LASP-1 correlating with reduced MMP9 transcript levels in MDA-MB-231S cells [PMC4651668]. Furthermore, mutations in MIR29B1 have been linked to altered physiological responses such as reduced urine volume and increased renal fibrosis under certain dietary conditions in rats [PMC6156712], highlighting its significance beyond neurodegenerative diseases.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 41 other species

  1. Aotus nancymaae (Ma's night monkey) microRNA 29b-1 (ENSANAG00000014030.1)
  2. Ateles geoffroyi (black-handed spider monkey) microRNA age-mir-29b precursor
  3. Bos taurus (cattle) microRNA bta-mir-29b precursor (bta-mir-29b-1)
  4. Capra hircus microRNA 29b-1 (ENSCHIG00000009164.1)
  5. Carlito syrichta microRNA 29b-1 (ENSTSYG00000026059.1)
  6. Cebus imitator (Panamanian white-faced capuchin) microRNA 29b-1 (ENSCCAG00000002159.1)
  7. Cercocebus atys (Sooty mangabey) microRNA 29b-1 (ENSCATG00000008809.1)
  8. Chlorocebus sabaeus microRNA 29b-1 (ENSCSAG00000027654.1)
  9. Colobus angolensis palliatus miRNA (ENSCANG00000005717.1)
  10. Equus caballus microRNA eca-mir-29b precursor
  11. Gorilla gorilla gorilla (Western Lowland Gorilla) ggo-mir-29b-1 (ENSGGOG00000034324.2)
  12. Gorilla gorilla microRNA ggo-mir-29b precursor (ggo-mir-29b-1)
  13. Lagothrix lagotricha microRNA lla-mir-29b precursor
  14. Loxodonta africana (African savanna elephant) microRNA 29b-1 (ENSLAFG00000024071.1)
  15. Macaca mulatta microRNA mml-mir-29b precursor (mml-mir-29b-1)
  16. Macaca nemestrina microRNA 29b-1 (ENSMNEG00000007424.1)
  17. Mandrillus leucophaeus (Drill) microRNA 29b-1 (ENSMLEG00000002577.1)
  18. Microcebus murinus (gray mouse lemur) microRNA 29b-1 (ENSMICG00000018084.3)
  19. Nomascus leucogenys microRNA 29b-1 (ENSNLEG00000022424.2)
  20. Otolemur garnettii microRNA 29b-1 (ENSOGAG00000020823.1)
  21. Ovis aries miRNA (ENSOARG00000022267.1)
  22. Pan paniscus (pygmy chimpanzee) microRNA ppa-mir-29b precursor (ppa-mir-29b-1)
  23. Panthera pardus microRNA 29b-1 (ENSPPRG00000014477.1)
  24. Panthera tigris altaica microRNA 29b-1 (ENSPTIG00000001757.1)
  25. Pan troglodytes (chimpanzee) microRNA ptr-mir-29b precursor (ptr-mir-29b-1)
  26. Pongo abelii (Sumatran orangutan) miRNA
  27. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-29b precursor (ppy-mir-29b-1)
  28. Propithecus coquereli microRNA 29b-1 (ENSPCOG00000009588.1)
  29. Pteropus vampyrus miRNA (ENSPVAG00000027791.1)
  30. Rhinopithecus bieti microRNA 29b-1 (ENSRBIG00000009855.1)
  31. Rhinopithecus roxellana (Golden snub-nosed monkey) microRNA 29b-1 (ENSRROG00000006154.1)
  32. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) microRNA 29b-1 (ENSSBOG00000010900.1)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

GoFlow Results Publications