v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Zea mays (maize) zma-miR167a-5p URS000013A25F_4577

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGAAGCUGCCAGCAUGAUCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 37 other species

  1. Aegilops tauschii ata-miR167a-5p
  2. Ananas comosus microRNA 167g
  3. Arabidopsis lyrata (lyrate rockcress) aly-miR167a-5p
  4. Arabidopsis thaliana ath-miR167b
  5. Asparagus officinalis (garden asparagus) aof-miR167a
  6. Brachypodium distachyon (stiff brome) bdi-miR167a
  7. Brassica napus (rape) bna-miR167c
  8. Brassica rapa (field mustard) bra-miR167d
  9. Carica papaya cpa-miR167a
  10. Citrus sinensis (sweet orange) csi-miR167e-5p
  11. Corchorus capsularis (jute) sRNA CCACVL1_14458
  12. Corchorus olitorius ahy-miR167-
  13. Cucumis melo (muskmelon) cme-miR167b
  14. Cynara cardunculus var. scolymus cca-miR167c
  15. Digitalis purpurea (common foxglove) dpr-miR167a
  16. Glycine max (soybean) gma-miR167b
  17. Gossypium hirsutum (cotton) ghr-miR167a
  18. Helianthus annuus ath-miR167a-5p
  19. Linum usitatissimum (flax) lus-miR167d
  20. Malus domestica mdm-miR167e
  21. Manihot esculenta mes-miR167c
  22. Medicago truncatula mtr-miR167a
  23. Moringa oleifera (horseradish tree) rco-miR167b
  24. Mus musculus (house mouse) rco-miR167a
  25. Nicotiana tabacum (common tobacco) nta-miR167d
  26. Oryza sativa (Asian cultivated rice) osa-miR167b
  27. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR167b
  28. Populus tomentosa Pto-miR167d
  29. Populus trichocarpa (black cottonwood) ptc-miR167d
  30. Prunus persica (peach) ppe-miR167b
  31. Ricinus communis rco-miR167b
  32. Solanum lycopersicum sly-miR167a
  33. Solanum tuberosum (potato) stu-miR167d-5p
  34. Sorghum bicolor sbi-miR167i
  35. Theobroma cacao (cacao) tcc-miR167a
  36. Triticum aestivum tae-miR167a
  37. Vitis vinifera vvi-miR167e
 Relationships

Molecular Relationships

 Publications