Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-200b-5p URS000012A1DD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-200b: Hsa-mir-200b is a microRNA (miRNA) that plays a significant role in the regulation of gene expression at the post-transcriptional level [PMC4525332]. The study hypothesized that higher RNA editing levels in a cell line would correlate with a reduced impact of hsa-mir-200b [PMC4793219]. This hypothesis is based on the premise that RNA editing could potentially alter miRNA binding sites or miRNA expression, thereby influencing the miRNA's regulatory effects [PMC4793219]. The visualization of hsa-mir-200b was crucial for understanding its interaction with target mRNAs and its role in cellular processes [PMC4525332]. Furthermore, the study's findings on hsa-mir-200b were consistent with previous research, which also reported similar expression patterns for this miRNA along with others such as hsa-miR-21, hsa-miR-155, and hsa-miR-221 [PMC2687417]. This consistency across studies suggests that these miRNAs may have common regulatory targets or be involved in similar pathways across different cell types or conditions [PMC2687417].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUCUUACUGGGCAGCAUUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Alligator mississippiensis Ami-Mir-8-P1a_5p* (star (passenger))
  2. Anolis carolinensis (green anole) Aca-Mir-8-P1a_5p* (star (passenger))
  3. Bos taurus (domestic cattle) Bta-Mir-8-P1a_5p* (star (passenger))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-8-P1a_5p* (star (passenger))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-8-P1a_5p* (star (passenger))
  6. Canis lupus familiaris (dog) cfa-miR-200b
  7. Cavia porcellus cpo-miR-200b-5p
  8. Chrysemys picta bellii (western painted turtle) Cpi-Mir-8-P1a_5p* (star (passenger))
  9. Chrysemys picta (Painted turtle) cpi-miR-200b-5p
  10. Columba livia (rock pigeon) cli-miR-200b-5p
  11. Dasypus novemcinctus dno-miR-200b-5p
  12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-8-P1a_5p* (star (passenger))
  13. Equus caballus (horse) Eca-Mir-8-P1a_5p* (star (passenger))
  14. Gallus gallus (chicken) Gga-Mir-8-P1a_5p* (star (passenger))
  15. Gekko japonicus Gja-Mir-8-P1a_5p* (star (passenger))
  16. Latimeria chalumnae (coelacanth) Lch-Mir-8-P1a_5p* (star (passenger))
  17. Loxodonta africana (African savanna elephant) Laf-Mir-8-P1a_5p* (star (passenger))
  18. Macaca fascicularis (crab-eating macaque) microRNA miR-200b-5p
  19. Macaca mulatta Mml-Mir-8-P1a_5p* (star (passenger))
  20. Microcaecilia unicolor Mun-Mir-8-P1a_5p* (star (passenger))
  21. Microcebus murinus (gray mouse lemur) Mmr-Mir-8-P1a_5p* (star (passenger))
  22. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-8-P1a_5p* (star (passenger))
  23. Mus musculus (house mouse) mmu-miR-200b-5p
  24. Notamacropus eugenii (tammar wallaby) Neu-Mir-8-P1a_5p* (star (passenger))
  25. Ornithorhynchus anatinus (platypus) Oan-Mir-8-P1a_5p* (star (passenger))
  26. Pongo abelii (Sumatran orangutan) Pab-Mir-8-P1a_5p* (star (passenger))
  27. Rattus norvegicus rno-miR-200b-5p
  28. Sarcophilus harrisii Sha-Mir-8-P1a_5p* (star (passenger))
  29. Scyliorhinus torazame Sto-Mir-8-P1a_5p* (star (passenger))
  30. Sphenodon punctatus (tuatara) Spt-Mir-8-P1a_5p* (star (passenger))
  31. Taeniopygia guttata Tgu-Mir-8-P1a_5p* (star (passenger))
  32. Xenopus laevis (African clawed frog) Xla-Mir-8-P1a2_5p* (star (passenger))
  33. Xenopus tropicalis Xtr-Mir-8-P1a_5p* (star (passenger))
Relationships

Molecular Relationships

Publications