v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-29b-1-5p URS00001123BD_9606

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUGGUUUCAUAUGGUGGUUUAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 27 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-29-P1b-v1_5p* (star (passenger))
  2. Anolis carolinensis (green anole) Aca-Mir-29-P1b-v1_5p* (star (passenger))
  3. Bos taurus (domestic cattle) Bta-Mir-29-P1b-v1_5p* (star (passenger))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-29-P1b-v1_5p* (star (passenger))
  5. Canis lupus familiaris (dog) Cfa-Mir-29-P1b-v1_5p* (star (passenger))
  6. Cavia porcellus (domestic guinea pig) cpo-miR-29b-5p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-29-P1b-v1_5p* (star (passenger))
  8. Columba livia cli-miR-29b-5p
  9. Cricetulus griseus cgr-miR-29b-5p
  10. Dasypus novemcinctus (nine-banded armadillo) dno-miR-29b-5p
  11. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-29-P1b-v1_5p* (star (passenger))
  12. Equus caballus (horse) Eca-Mir-29-P1b-v1_5p* (star (passenger))
  13. Gallus gallus Gga-Mir-29-P1b-v1_5p* (star (passenger))
  14. Latimeria chalumnae (coelacanth) Lch-Mir-29-P1b_5p* (star (passenger))
  15. Lepisosteus oculatus (spotted gar) Loc-Mir-29-P1b-v1_5p* (star (passenger))
  16. Loxodonta africana (African savanna elephant) Laf-Mir-29-P1b-v1_5p* (star (passenger))
  17. Macaca mulatta (Rhesus monkey) Mml-Mir-29-P1b-v1_5p* (star (passenger))
  18. Microcebus murinus (gray mouse lemur) Mmr-Mir-29-P1b-v1_5p* (star (passenger))
  19. Monodelphis domestica mdo-miR-29b-1-5p
  20. Mus musculus Mmu-Mir-29-P1b-v1_5p* (star (passenger))
  21. Ornithorhynchus anatinus (platypus) Oan-Mir-29-P1b-v1_5p* (star (passenger))
  22. Oryctolagus cuniculus (rabbit) ocu-miR-29b-5p
  23. Pongo abelii (Sumatran orangutan) Pab-Mir-29-P1b-v1_5p* (star (passenger))
  24. Rattus norvegicus (Norway rat) Rno-Mir-29-P1b-v1_5p* (star (passenger))
  25. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-29-P1b-v1_5p* (star (passenger))
  26. Sphenodon punctatus (tuatara) Spt-Mir-29-P1b_5p* (star (passenger))
  27. Taeniopygia guttata (zebra finch) Tgu-Mir-29-P1b-v1_5p* (star (passenger))
 Relationships

Molecular Relationships

 Publications