Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila melanogaster (fruit fly) microRNA dme-mir-100 precursor secondary structure diagram

Drosophila melanogaster (fruit fly) microRNA dme-mir-100 precursor URS00000FCF87_7227

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

dme-mir-100: Dme-mir-100 is a derived mature microRNA that is assigned the name dme-mir-100 for the guide strand and dme-mir-100* for the passenger strand [PMC4451068]. The prefix "dme" in dme-mir-100 designates the organism, Drosophila melanogaster, and is followed by sequentially assigned numbers [PMC4718083]. Dme-mir-100, along with dme-miR-92a and dme-miR-124, was selected based on data generated in a laboratory and their orthology with human miRNAs [PMC5090246]. Drosophila miRNAs, including dme-mir-100, show extensive overall similarity with human miRNAs with 5' mismatches [PMC2486268]. The expression profiles of dme-mir-100 have low correlation coefficients with profiles of its corresponding miRNA* [PMC3150300]. A weak correlation between dme-mir-100 and its passenger strand (dme-mir-100*) suggests possible regulation during its maturation [PMC3150300]. Notably, tissue-specific A-to-I editing of dme-mir-100 has been observed in male heads and a cell line [PMC3150300]. The expression profiles of dme-miR-305, along with other miRNAs including dme-miR-283 and dmiR992, are weakly correlated to at least one miRNA from their clusters [PMC3150300]. Independent regulation of both Drosophila let7 (dmiR let7) and mir 100 has been observed during post-transcriptional regulation [PMC3150300]. Several other miRNAs have also been reported to be involved in metamorphosis development in insects including DmiR125, DmiR34a, and DmiR14 [PMC5689003].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAUUAACAGAAACCCGUAAAUCCGAACUUGUGCUGUUUUAUAUCUGUUACAAGACCGGCAUUAUGGGAGUCUGUCAAUGCAAACAACUGGUUUUUGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications