v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ornithorhynchus anatinus (platypus) oan-miR-221-3p URS000009C94C_9258

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCUACAUUGUCUGCUGGGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Anolis carolinensis aca-miR-221-3p
  2. Bos taurus (domestic cattle) bta-miR-221
  3. Canis lupus familiaris (dog) cfa-miR-221
  4. Capra hircus (goat) chi-miR-221-3p
  5. Chrysemys picta cpi-miR-221-3p
  6. Columba livia (rock pigeon) cli-miR-221-3p
  7. Gadus morhua gmo-miR-221-3p
  8. Ictalurus punctatus ipu-miR-221
  9. Microcaecilia unicolor Mun-Mir-221-P2a_3p (mature (guide))
  10. Mus musculus Mus_musculus piRNA piR-mmu-72620
  11. Ovis aries oar-miR-221
  12. Paralichthys olivaceus pol-miR-221-3p
  13. Pteropus alecto pal-miR-221-3p
  14. Python bivittatus pbv-miR-221-3p
  15. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62979
  16. Salmo salar (Atlantic salmon) ssa-miR-221-5p
  17. Sus scrofa (pig) ssc-miR-221-3p
  18. Xenopus laevis (African clawed frog) xla-miR-221-3p
  19. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3647375
 Relationships

Molecular Relationships

 Publications