Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1909-3p URS000009A9A2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1909: Hsa-mir-1909 is a microRNA (miRNA) that is highly expressed in human embryonic stem cells (hESCs) and plays a role in their physiology by targeting the Notch signaling pathway [PMC3275573]. In human dermal fibroblasts, exposure to a biological drug for two hours altered the expression of hsa-mir-1909 among other miRNAs, suggesting its involvement in response to external biological stimuli [PMC5816894]. Hsa-mir-1909 has also been identified as part of a module that includes other miRNAs potentially involved in regulatory networks as indicated by module #161 [PMC9618768]. Genetic variants such as c.1130 G>T have been predicted to affect the binding and function of hsa-mir-1909, potentially altering its regulatory impact on target genes [PMC3444488]. Although there is limited information on its role in glioblastoma, hsa-mir-1909 has been noted for its expression in the early stages of gastric cancer, indicating its potential involvement in cancer development or progression [PMC9432466].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGCAGGGGCCGGGUGCUCACCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications