Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-107 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-107 precursor URS000008F0CF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-107: The microRNA hsa-mir-107 has been identified as significantly upregulated in the FGD5-AS1 KD CCC-HEH-2 cell line, which could indicate its involvement in specific cellular functions within this system [PMC8144506]. This cell line originates from cholangiocarcinoma, a cancer affecting the bile ducts, and the observed upregulation of hsa-mir-107 suggests it may influence the behavior of these cancer cells [PMC8144506]. In addition, hsa-mir-107 is also recognized for its potential tumor-suppressive effects in non-small cell lung cancer (NSCLC) cells, highlighting its relevance in cancer research [PMC6981095]. The connections of hsa-mir-107 with various cancer types underscore its significance in the field of cancer biology and emphasize the need for further studies to elucidate its role and therapeutic possibilities [PMC8144506; PMC6981095].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUCUCUGCUUUCAGCUUCUUUACAGUGUUGCCUUGUGGCAUGGAGUUCAAGCAGCAUUGUACAGGGCUAUCAAAGCACAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Expression GoFlow Results Publications