Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30d-5p URS000005CF5F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-30d: Hsa-mir-30d is a microRNA that has been observed to play a role in the endometrial receptivity, a crucial factor for successful implantation during the reproductive cycle [PMC5339930]. Specifically, hsa-mir-30d is significantly upregulated in the receptive endometrium when compared to the prereceptive phase, suggesting its potential involvement in the molecular changes that prepare the endometrium for embryo implantation [PMC5339930]. Additionally, hsa-mir-30d has been identified as a potential predictive biomarker for sorafenib response in hepatocellular carcinoma (HCC) patients when its levels are measured in serum samples [PMC7377167]. This indicates that hsa-mir-30d may have broader implications beyond reproductive biology and could be significant in therapeutic response prediction for certain cancers [PMC7377167].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCCCGACUGGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Anolis carolinensis aca-miR-30d-5p
  2. Capra hircus (goat) miR-30d
  3. Danio rerio (zebrafish) dre-miR-30d
  4. Equus caballus (horse) eca-miR-30d
  5. Gallus gallus (chicken) gga-miR-30d
  6. Gorilla gorilla gorilla ggo-miR-30d (MIR30D)
  7. Gorilla gorilla (western gorilla) ggo-miR-30d
  8. Macaca mulatta mml-miR-30d-5p
  9. Macaca nemestrina mne-miR-30d
  10. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30e-5p
  11. Mus musculus (house mouse) mmu-miR-30d-5p
  12. Ovis aries (sheep) miscellaneous RNA
  13. Pan paniscus ppa-miR-30d
  14. Pan troglodytes (chimpanzee) ptr-miR-30d
  15. Pongo pygmaeus ppy-miR-30d
  16. Rattus norvegicus rno-miR-30d-5p
  17. Takifugu rubripes fru-miR-30d
  18. Tetraodon nigroviridis tni-miR-30d
  19. Tor tambroides (Thai mahseer) miR-30b
  20. Xenopus tropicalis (tropical clawed frog) xtr-miR-30d
Relationships

Molecular Relationships

GoFlow Results Publications