Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-211-3p URS0000044FD7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-211: Hsa-mir-211 is a type of microRNA (miRNA) that has been identified as one of eight miRNAs selected for their potential relevance in a study focused on melanoma [PMC5520514]. While hsa-miR-181b is noted for its numerous potential target genes and its implication in the progression and metastasis of melanoma, hsa-mir-211's specific role in these processes is not detailed in the provided context [PMC8728391]. Nevertheless, the inclusion of hsa-mir-211 in the selected group of miRNAs suggests it may play a significant role in melanoma, which could be a subject for further investigation [PMC5520514].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGGGACAGCAAAGGGGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships New

Molecular Relationships

Publications