Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-5100 URS0000044E25_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-5100: mmu-mir-5100 is a microRNA sequence found in mouse B cells, with a notable presence on chromosome 11 [PMC4488125][PMC5595893]. It is among the miRNAs with varied expression levels, being one of the highly expressed miRNAs in certain studies, while in others, it is found to have low expression [PMC5595893][PMC3555835]. Notably, mmu-mir-5100 has been identified to have target genes such as Podxl, Rab6b, and Rab6a that are significantly downregulated in neutrophils during pneumonia; however, the expression of mmu-mir-5100 itself does not change [PMC5595893]. In studies utilizing next-generation sequencing and microarray analysis, mmu-mir-5100 has been detected as differentially expressed and upregulated under certain conditions such as LPS treatment [PMC4079956][PMC7945321]. Despite these findings on its expression and target genes, mmu-mir-5100's functional roles and implications in physiological or disease processes require further investigation to fully understand its impact on cellular processes.

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGAAUCCCAGCGGUGCCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships

Molecular Relationships

Publications