Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-378f URS0000043B1D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-378f: Hsa-mir-378f is a microRNA (miRNA) that has been identified as a significant element in various biological processes and diseases [PMC9180980]. This miRNA is notably downregulated in certain conditions, such as XELOX-chemotherapy-induced peripheral neuropathy, and has been associated with a substantial change in expression levels [PMC9180980], [PMC9523404]. It targets multiple genes, including IGF1R, and is involved in the regulation of numerous pathways [PMC6595612], [PMC7880712]. Hsa-mir-378f's expression was notably lower compared to control groups in certain studies, indicating its potential role as a biomarker for disease states or treatment responses [PMC9180980]. It was also identified as one of the miRNAs with the greatest expression changes among downregulated target miRNAs in specific disease conditions [PMC9523404]. Furthermore, hsa-mir-378f's interactions with long non-coding RNAs (lncRNAs) have been predicted through bioinformatics tools, suggesting its involvement in complex regulatory networks that could influence pathological changes and tumor development or progression based on the competing endogenous RNA (ceRNA) hypothesis [PMC9523404], [PMC9597465].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGGACUUGGAGCCAGAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Relationships New

Molecular Relationships

Publications