Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-944 URS000004203C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-944: Hsa-mir-944 is a microRNA implicated in the regulation of gene expression in various cellular processes [PMC8460735]. In the context of breast cancer (BC), a recent study has demonstrated that circBACH2 can act as a molecular sponge for hsa-mir-944 [PMC8709995]. This interaction leads to the upregulation of HNRNPC, an m6A RNA methylation modulator, which in turn is associated with accelerated progression of BC [PMC8709995]. Conversely, it has been hypothesized that hsa-mir-944 may play an inhibitory role in the progression of gastric cancer (GC), suggesting a potential tumor suppressive function in this context [PMC8460735].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAUUAUUGUACAUCGGAUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-944
Relationships

Molecular Relationships

Publications