Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Callithrix jacchus (white-tufted-ear marmoset) Callithrix_jacchus piRNA piR-cja-2125085
URS00002198F3_9483
Genome locations
Gene Ontology annotations
Loading ontology ancestors...
Failed to load QuickGO Ancestor chart
![]()
Sequence
Sequence features are shown above as colored rectangles.
Zoom in and click to view details, or
Reset
UAGGCAGUGUAUUGCUAGCGGCUGU
Taxonomic tree
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree.
Click tree nodes to collapse or expand them.
Hover over taxon names to display additional information.
This sequence is found in 1 other species
Download
